Transcript: Human NM_152637.3

Homo sapiens methyltransferase like 7B (METTL7B), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
METTL7B (196410)
Length:
1316
CDS:
20..754

Additional Resources:

NCBI RefSeq record:
NM_152637.3
NBCI Gene record:
METTL7B (196410)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236248 GAACGCCCAGTTCTCCGAAAT pLKO_005 658 CDS 100% 10.800 15.120 N METTL7B n/a
2 TRCN0000236251 GAGAACAGGCACCTCCAATAT pLKO_005 356 CDS 100% 13.200 10.560 N METTL7B n/a
3 TRCN0000236250 ATGGGAAAGGCTGTCAAATAA pLKO_005 734 CDS 100% 15.000 10.500 N METTL7B n/a
4 TRCN0000236249 GAGCTCTTCAGCCAGATAAAG pLKO_005 188 CDS 100% 13.200 9.240 N METTL7B n/a
5 TRCN0000178938 CCAGTTCTCCGAAATCCAAAT pLKO.1 664 CDS 100% 10.800 7.560 N METTL7B n/a
6 TRCN0000148845 CAGGGCAATCTCTAACTTCAA pLKO.1 912 3UTR 100% 4.950 3.465 N METTL7B n/a
7 TRCN0000181071 CGGAGCCAACTTTCAGTTCTA pLKO.1 262 CDS 100% 4.950 3.465 N METTL7B n/a
8 TRCN0000148368 CGAAATCCAAATGGAACGACA pLKO.1 673 CDS 100% 2.640 1.848 N METTL7B n/a
9 TRCN0000236252 CAAGCTCCAAGGCACTCATTT pLKO_005 762 3UTR 100% 13.200 7.920 N METTL7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.