Transcript: Human NM_152640.5

Homo sapiens decapping mRNA 1B (DCP1B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
DCP1B (196513)
Length:
2033
CDS:
27..1880

Additional Resources:

NCBI RefSeq record:
NM_152640.5
NBCI Gene record:
DCP1B (196513)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152640.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433307 GATTGTCCATCTATGGAATTT pLKO_005 343 CDS 100% 13.200 17.160 N DCP1B n/a
2 TRCN0000435954 ATAATCTATGAAGCCTATCTC pLKO_005 1821 CDS 100% 4.950 3.960 N DCP1B n/a
3 TRCN0000107677 CCTAACTCAGTATGAACAGTT pLKO.1 413 CDS 100% 4.950 3.960 N DCP1B n/a
4 TRCN0000107676 CCTTTCCTTCTCTACAGAAAT pLKO.1 318 CDS 100% 13.200 9.240 N DCP1B n/a
5 TRCN0000107679 GACGAATACACAAAGTGTAAA pLKO.1 534 CDS 100% 13.200 9.240 N DCP1B n/a
6 TRCN0000432694 ATTACTAAAGACTTGGATTTC pLKO_005 285 CDS 100% 10.800 7.560 N DCP1B n/a
7 TRCN0000424794 CAAAGCATGGATTCACCATTA pLKO_005 229 CDS 100% 10.800 7.560 N DCP1B n/a
8 TRCN0000107675 GCCATCTATGACAATCCAAAT pLKO.1 591 CDS 100% 10.800 7.560 N DCP1B n/a
9 TRCN0000430708 TATCCTTGACAGCTCTGTTTG pLKO_005 703 CDS 100% 10.800 7.560 N DCP1B n/a
10 TRCN0000107678 CCTCATTCAGAATGATGACAA pLKO.1 1790 CDS 100% 4.950 3.465 N DCP1B n/a
11 TRCN0000437487 AGTACCCATTCTGCGGGAGAA pLKO_005 984 CDS 100% 4.050 2.835 N DCP1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152640.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.