Transcript: Human NM_152701.5

Homo sapiens ATP binding cassette subfamily A member 13 (ABCA13), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ABCA13 (154664)
Length:
17188
CDS:
27..15203

Additional Resources:

NCBI RefSeq record:
NM_152701.5
NBCI Gene record:
ABCA13 (154664)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152701.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424645 ACGTATTCTAGACACGTTAAA pLKO_005 4142 CDS 100% 13.200 18.480 N ABCA13 n/a
2 TRCN0000427709 TGTATCACATGATCGAGATTT pLKO_005 4034 CDS 100% 13.200 18.480 N ABCA13 n/a
3 TRCN0000059806 GCCCAGAGTTAAGGAACTCTT pLKO.1 9824 CDS 100% 0.495 0.693 N ABCA13 n/a
4 TRCN0000059807 GCTGTGATAGATGTGTACTAT pLKO.1 5250 CDS 100% 5.625 4.500 N ABCA13 n/a
5 TRCN0000059803 CGCATAATCTACTCTCTTTAT pLKO.1 6082 CDS 100% 13.200 9.240 N ABCA13 n/a
6 TRCN0000059804 GCCACATCAATGGACTCCATT pLKO.1 7572 CDS 100% 4.950 3.465 N ABCA13 n/a
7 TRCN0000059805 CCTCCCAGATACAGAGACATT pLKO.1 168 CDS 100% 4.950 2.970 N ABCA13 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 16467 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 16467 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152701.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.