Transcript: Human NM_152742.3

Homo sapiens glypican 2 (GPC2), mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
GPC2 (221914)
Length:
2546
CDS:
183..1922

Additional Resources:

NCBI RefSeq record:
NM_152742.3
NBCI Gene record:
GPC2 (221914)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152742.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440980 GAGGGTAGAGAAGGGACTTTG pLKO_005 2018 3UTR 100% 10.800 7.560 N GPC2 n/a
2 TRCN0000220036 GGGATATAGCTTAAACCTAAT pLKO.1 308 CDS 100% 10.800 7.560 N GPC2 n/a
3 TRCN0000220037 TGTGGTCAGCGAAGCGCTTAA pLKO.1 890 CDS 100% 10.800 7.560 N GPC2 n/a
4 TRCN0000439661 ATGACACCCTGGCGGATTTCT pLKO_005 661 CDS 100% 5.625 3.938 N GPC2 n/a
5 TRCN0000149403 GTTTGATGTACCTGCAGGAAA pLKO.1 1162 CDS 100% 4.950 3.465 N GPC2 n/a
6 TRCN0000147974 GAGTCCATGTTTATTCTGCAA pLKO.1 2506 3UTR 100% 2.640 1.848 N GPC2 n/a
7 TRCN0000180568 GCAGTATGCAGATGACTGGAT pLKO.1 1700 CDS 100% 2.640 1.848 N GPC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152742.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.