Transcript: Human NM_152753.4

Homo sapiens signal peptide, CUB domain and EGF like domain containing 3 (SCUBE3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SCUBE3 (222663)
Length:
7819
CDS:
464..3445

Additional Resources:

NCBI RefSeq record:
NM_152753.4
NBCI Gene record:
SCUBE3 (222663)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152753.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435070 ATAGATGAGTGCCGCTTAAAC pLKO_005 1295 CDS 100% 13.200 18.480 N SCUBE3 n/a
2 TRCN0000414883 ACCCAAGCGCAAGATCCTTAT pLKO_005 2974 CDS 100% 10.800 15.120 N SCUBE3 n/a
3 TRCN0000055926 CGTTTGCACCTGCGAAACAAA pLKO.1 1940 CDS 100% 5.625 7.875 N SCUBE3 n/a
4 TRCN0000434525 AGTTGCAAGAAAGGCTATAAG pLKO_005 1367 CDS 100% 13.200 9.240 N SCUBE3 n/a
5 TRCN0000055925 CCATCCTCCATTACCACTTAT pLKO.1 3068 CDS 100% 13.200 9.240 N SCUBE3 n/a
6 TRCN0000416173 GTAAATTGACATGCAACTATG pLKO_005 1053 CDS 100% 10.800 7.560 N SCUBE3 n/a
7 TRCN0000055924 GCTTCCAGATTCCCTATGTTA pLKO.1 3186 CDS 100% 5.625 3.938 N SCUBE3 n/a
8 TRCN0000055927 GCAGAGCTGTGTCAACATGAT pLKO.1 835 CDS 100% 4.950 3.465 N SCUBE3 n/a
9 TRCN0000055923 GCCAGGATATAGACGAGTGTT pLKO.1 1410 CDS 100% 4.950 3.465 N SCUBE3 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6148 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6148 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152753.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.