Transcript: Human NM_152770.2

Homo sapiens cilia and flagella associated protein 299 (CFAP299), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
CFAP299 (255119)
Length:
903
CDS:
50..751

Additional Resources:

NCBI RefSeq record:
NM_152770.2
NBCI Gene record:
CFAP299 (255119)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148069 GATAATCCAGAAGGCTTACTT pLKO.1 590 CDS 100% 5.625 7.875 N CFAP299 n/a
2 TRCN0000128396 GCAAGAGATATCAGGATACAT pLKO.1 418 CDS 100% 5.625 7.875 N CFAP299 n/a
3 TRCN0000149404 GTCACTCAATTCAACGCCTAT pLKO.1 89 CDS 100% 4.050 5.670 N CFAP299 n/a
4 TRCN0000425098 ACTTAAGTACCAACATGTTAA pLKO_005 746 CDS 100% 13.200 9.240 N CFAP299 n/a
5 TRCN0000434514 TGGTAAAGACCTACAAGATAA pLKO_005 307 CDS 100% 13.200 9.240 N CFAP299 n/a
6 TRCN0000420189 GACTATGCCCACAGGCTAAAG pLKO_005 440 CDS 100% 10.800 7.560 N CFAP299 n/a
7 TRCN0000148180 GCAATGAGAGAAGAAGACAAT pLKO.1 344 CDS 100% 4.950 3.465 N CFAP299 n/a
8 TRCN0000146541 GCTGGTAAAGACCTACAAGAT pLKO.1 305 CDS 100% 4.950 3.465 N CFAP299 n/a
9 TRCN0000127852 GCAGATCACTACTGTGGACTT pLKO.1 127 CDS 100% 4.050 2.835 N CFAP299 n/a
10 TRCN0000130871 GACTTGTACTACCTGGAGGAT pLKO.1 143 CDS 100% 2.640 1.848 N CFAP299 n/a
11 TRCN0000128125 CGCCTATGAAGATTTCCTGGA pLKO.1 103 CDS 100% 2.160 1.512 N CFAP299 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.