Transcript: Mouse NM_152823.4

Mus musculus unc-5 family C-terminal like (Unc5cl), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Unc5cl (76589)
Length:
2838
CDS:
134..1690

Additional Resources:

NCBI RefSeq record:
NM_152823.4
NBCI Gene record:
Unc5cl (76589)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_152823.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178966 CATTCTGGAATTGTTCGAGGA pLKO.1 1501 CDS 100% 2.160 3.024 N Unc5cl n/a
2 TRCN0000250050 GGAAACCAAATACGTTGAAAT pLKO_005 1258 CDS 100% 13.200 9.240 N Unc5cl n/a
3 TRCN0000257989 CACCCGCCAGATGATGCATAA pLKO_005 409 CDS 100% 10.800 7.560 N Unc5cl n/a
4 TRCN0000250049 CCACTCCATTACCAGAGTATG pLKO_005 300 CDS 100% 10.800 7.560 N Unc5cl n/a
5 TRCN0000257985 TTGGAGTCTGTTCTGCGAAAT pLKO_005 2074 3UTR 100% 10.800 7.560 N Unc5cl n/a
6 TRCN0000179209 GATGCATAAGCTACTGGTGTT pLKO.1 421 CDS 100% 4.050 2.835 N Unc5cl n/a
7 TRCN0000215380 CATTAACCAATGAGATCATTG pLKO.1 1209 CDS 100% 1.080 0.756 N Unc5cl n/a
8 TRCN0000250048 TGAAGAGTGCTCGGCATTAAC pLKO_005 1195 CDS 100% 13.200 7.920 N Unc5cl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152823.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.