Transcript: Human NM_153036.5

Homo sapiens calcium homeostasis modulator family member 4 (CALHM4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CALHM4 (221301)
Length:
3559
CDS:
257..643

Additional Resources:

NCBI RefSeq record:
NM_153036.5
NBCI Gene record:
CALHM4 (221301)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153036.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412535 ATCGCATAAAGAAGCTATTTG pLKO_005 435 CDS 100% 13.200 18.480 N CALHM4 n/a
2 TRCN0000421217 GTAAGTCCATCTCAAATATTA pLKO_005 762 3UTR 100% 15.000 10.500 N CALHM4 n/a
3 TRCN0000134592 GAAGACAGATCAAGAGGTATT pLKO.1 608 CDS 100% 10.800 7.560 N CALHM4 n/a
4 TRCN0000413453 TGACTTGCAAGGTCACTATAG pLKO_005 553 CDS 100% 10.800 7.560 N CALHM4 n/a
5 TRCN0000135869 CCAGAATGAGAGAGAACTCTT pLKO.1 373 CDS 100% 4.950 3.465 N CALHM4 n/a
6 TRCN0000136031 GCTTAGCAGATACTTGGCTTT pLKO.1 670 3UTR 100% 4.050 2.835 N CALHM4 n/a
7 TRCN0000133966 CCATGTCTTCTATTCACCATT pLKO.1 1079 3UTR 100% 4.950 2.970 N CALHM4 n/a
8 TRCN0000135418 GAGGATAATGAGGAAGACAGA pLKO.1 596 CDS 100% 2.640 1.584 N CALHM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153036.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.