Transcript: Mouse NM_153062.2

Mus musculus solute carrier family 37 (glycerol-3-phosphate transporter), member 1 (Slc37a1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Slc37a1 (224674)
Length:
2942
CDS:
435..2030

Additional Resources:

NCBI RefSeq record:
NM_153062.2
NBCI Gene record:
Slc37a1 (224674)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153062.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070152 GATTAGGTATTACCTGACTTT pLKO.1 809 CDS 100% 4.950 6.930 N Slc37a1 n/a
2 TRCN0000070149 CCACTTGTGGTCTGATGCTAT pLKO.1 1612 CDS 100% 4.950 3.465 N Slc37a1 n/a
3 TRCN0000070151 CGTGTTCTACATGCTGATGTT pLKO.1 1907 CDS 100% 4.950 3.465 N Slc37a1 n/a
4 TRCN0000070150 GCTCTATGCAAGCTTCCACTT pLKO.1 524 CDS 100% 4.050 2.835 N Slc37a1 n/a
5 TRCN0000070148 CCTCAGCAACTGGTTTGGAAA pLKO.1 971 CDS 100% 4.950 2.970 N Slc37a1 n/a
6 TRCN0000043291 CGAAAGCCTATCAGCATAGTT pLKO.1 549 CDS 100% 5.625 7.875 N SLC37A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153062.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.