Transcript: Mouse NM_153071.1

Mus musculus G protein-coupled receptor, family C, group 6, member A (Gprc6a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gprc6a (210198)
Length:
2856
CDS:
28..2814

Additional Resources:

NCBI RefSeq record:
NM_153071.1
NBCI Gene record:
Gprc6a (210198)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026076 GCCGTGGAGATTATAGTCATT pLKO.1 2467 CDS 100% 4.950 6.930 N Gprc6a n/a
2 TRCN0000026134 CCGGGACTCATTTATAGCATT pLKO.1 1252 CDS 100% 4.950 3.960 N Gprc6a n/a
3 TRCN0000026069 CCAGCCTTCCTCTCAGATAAT pLKO.1 763 CDS 100% 13.200 9.240 N Gprc6a n/a
4 TRCN0000026067 CCCTGTCTATACTACCACATT pLKO.1 2430 CDS 100% 4.950 3.465 N Gprc6a n/a
5 TRCN0000026141 CGTGAAATCATCTGGAGGATT pLKO.1 1896 CDS 100% 4.950 3.465 N Gprc6a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.