Transcript: Mouse NM_153083.5

Mus musculus thiamine triphosphatase (Thtpa), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Thtpa (105663)
Length:
2839
CDS:
677..1351

Additional Resources:

NCBI RefSeq record:
NM_153083.5
NBCI Gene record:
Thtpa (105663)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153083.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271651 TTAGCCGTGATCAGTAGTTAA pLKO_005 1609 3UTR 100% 13.200 18.480 N THTPA n/a
2 TRCN0000201985 CCATTGATTTCCGCTCGTGTT pLKO.1 1574 3UTR 100% 4.050 5.670 N Thtpa n/a
3 TRCN0000202336 GCCTCAGCTCACAATAGACTT pLKO.1 1093 CDS 100% 4.950 3.465 N Thtpa n/a
4 TRCN0000190064 GAGCTCAAATGTCCTGGAGTA pLKO.1 863 CDS 100% 4.050 2.835 N Thtpa n/a
5 TRCN0000189960 GCCAAGCTCATGGTATACCTA pLKO.1 1250 CDS 100% 3.000 2.100 N Thtpa n/a
6 TRCN0000190800 GTTAAGCCTTATGCTGTCTGA pLKO.1 808 CDS 100% 2.640 1.848 N Thtpa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153083.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.