Transcript: Mouse NM_153092.4

Mus musculus nucleoporin like 2 (Nupl2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Nupl2 (231042)
Length:
2909
CDS:
115..1377

Additional Resources:

NCBI RefSeq record:
NM_153092.4
NBCI Gene record:
Nupl2 (231042)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153092.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243492 TCGAGCTTCTGACTGTATAAA pLKO_005 1358 CDS 100% 15.000 21.000 N Nupl2 n/a
2 TRCN0000430737 TAACTTCTTAACCAGCAATAA pLKO_005 603 CDS 100% 13.200 18.480 N NUP42 n/a
3 TRCN0000243493 GTTTGGAGGTAGCGGCATATC pLKO_005 1203 CDS 100% 10.800 15.120 N Nupl2 n/a
4 TRCN0000194646 GAGATCAGGACAAACCACCAT pLKO.1 338 CDS 100% 2.640 2.112 N Nupl2 n/a
5 TRCN0000243495 AGTTGTGAGGCACCATATAAA pLKO_005 2005 3UTR 100% 15.000 10.500 N Nupl2 n/a
6 TRCN0000243494 TAACTTACAGAGCTATCTAAA pLKO_005 621 CDS 100% 13.200 9.240 N Nupl2 n/a
7 TRCN0000241827 GTTGAGGCTTGAATACCATAA pLKO_005 585 CDS 100% 10.800 7.560 N Nupl2 n/a
8 TRCN0000194170 GAAACTTCTGGAAGGAATTGT pLKO.1 456 CDS 100% 5.625 3.938 N Nupl2 n/a
9 TRCN0000173199 CCAGTGAGAAAGAAACCCAAT pLKO.1 532 CDS 100% 4.050 2.835 N Nupl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153092.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.