Transcript: Mouse NM_153116.1

Mus musculus GTP-binding protein 10 (putative) (Gtpbp10), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gtpbp10 (207704)
Length:
2932
CDS:
37..1137

Additional Resources:

NCBI RefSeq record:
NM_153116.1
NBCI Gene record:
Gtpbp10 (207704)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153116.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252531 CCCGCACTCTTAGCAATTAAT pLKO_005 850 CDS 100% 15.000 21.000 N Gtpbp10 n/a
2 TRCN0000252528 TCCTGATGTGGGTACTAATTA pLKO_005 1857 3UTR 100% 15.000 21.000 N Gtpbp10 n/a
3 TRCN0000258224 TGATTGCAGATTATGCGTTTA pLKO_005 557 CDS 100% 10.800 15.120 N Gtpbp10 n/a
4 TRCN0000252529 TTGCCGGATGCCCAAGTTAAA pLKO_005 880 CDS 100% 13.200 10.560 N Gtpbp10 n/a
5 TRCN0000252530 GTGCTAGGAGAACTCAATAAA pLKO_005 349 CDS 100% 15.000 10.500 N Gtpbp10 n/a
6 TRCN0000216506 CATAGTTCACCTTGACCTAAA pLKO.1 453 CDS 100% 10.800 7.560 N Gtpbp10 n/a
7 TRCN0000184337 GCCACAAGTTCCTCAAGCATT pLKO.1 686 CDS 100% 4.950 3.465 N Gtpbp10 n/a
8 TRCN0000179168 GCCCAAGTTAAACTTCAGGAA pLKO.1 889 CDS 100% 2.640 1.584 N Gtpbp10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153116.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.