Transcript: Mouse NM_153127.3

Mus musculus multimerin 2 (Mmrn2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mmrn2 (105450)
Length:
3935
CDS:
112..2943

Additional Resources:

NCBI RefSeq record:
NM_153127.3
NBCI Gene record:
Mmrn2 (105450)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153127.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191256 CCATGTTGAGTAAGAAAGATA pLKO.1 2438 CDS 100% 5.625 4.500 N Mmrn2 n/a
2 TRCN0000257620 AGAGCGTGGTTTGAGTTAATC pLKO_005 2854 CDS 100% 13.200 9.240 N Mmrn2 n/a
3 TRCN0000247277 AGCCAACACATGGTTGAATTA pLKO_005 3539 3UTR 100% 13.200 9.240 N Mmrn2 n/a
4 TRCN0000200604 CCCAGAGTTTAATGAGATTAA pLKO.1 603 CDS 100% 13.200 9.240 N Mmrn2 n/a
5 TRCN0000257647 CGGGTCATGCAGACCTCATTA pLKO_005 1550 CDS 100% 13.200 9.240 N Mmrn2 n/a
6 TRCN0000257648 AGAGCTGCGGGTGATCCTAAT pLKO_005 1443 CDS 100% 10.800 7.560 N Mmrn2 n/a
7 TRCN0000200561 CAGAAGCCAATCTAACAGAAT pLKO.1 743 CDS 100% 4.950 3.465 N Mmrn2 n/a
8 TRCN0000257759 TGAGGTGAGCACCAAGTTAAA pLKO_005 1104 CDS 100% 13.200 7.920 N Mmrn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153127.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.