Transcript: Mouse NM_153137.4

Mus musculus TRAF3 interacting protein 3 (Traf3ip3), mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Mus musculus (mouse)
Gene:
Traf3ip3 (215243)
Length:
2142
CDS:
417..1958

Additional Resources:

NCBI RefSeq record:
NM_153137.4
NBCI Gene record:
Traf3ip3 (215243)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153137.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364214 GAACAGGAGAAGCTCTTAAAG pLKO_005 1704 CDS 100% 13.200 10.560 N Traf3ip3 n/a
2 TRCN0000088469 GCATTGCCAACAATAAAGAAT pLKO.1 930 CDS 100% 5.625 4.500 N Traf3ip3 n/a
3 TRCN0000088468 CTGGCATCTATCTGAAGTAAA pLKO.1 1966 3UTR 100% 13.200 9.240 N Traf3ip3 n/a
4 TRCN0000218531 GGACCTACAAGATCAACTAAA pLKO_005 1598 CDS 100% 13.200 9.240 N TRAF3IP3 n/a
5 TRCN0000368869 GGACCTACAAGATCAACTAAA pLKO_005 1598 CDS 100% 13.200 9.240 N Traf3ip3 n/a
6 TRCN0000364213 CATCATTCAACTCTCGGAATA pLKO_005 998 CDS 100% 10.800 7.560 N Traf3ip3 n/a
7 TRCN0000088471 CAGGGATAAGCTCTGAGGTTT pLKO.1 763 CDS 100% 4.950 3.465 N Traf3ip3 n/a
8 TRCN0000088470 CCAAAGCTCTCCCTTGATGAA pLKO.1 1752 CDS 100% 4.950 3.465 N Traf3ip3 n/a
9 TRCN0000088472 GACAGCAGGAAACAGGGATAA pLKO.1 751 CDS 100% 10.800 6.480 N Traf3ip3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153137.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.