Transcript: Mouse NM_153141.1

Mus musculus coactivator-associated arginine methyltransferase 1 (Carm1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Carm1 (59035)
Length:
3151
CDS:
115..1872

Additional Resources:

NCBI RefSeq record:
NM_153141.1
NBCI Gene record:
Carm1 (59035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039114 GCCATGAAGATGTGTGTGTTT pLKO.1 335 CDS 100% 4.950 6.930 N Carm1 n/a
2 TRCN0000039117 CCACGATTTCTGTTCTTTCTA pLKO.1 459 CDS 100% 5.625 3.938 N Carm1 n/a
3 TRCN0000007168 GCAGAACATGATGCAGGACTA pLKO.1 594 CDS 100% 4.050 2.835 N CARM1 n/a
4 TRCN0000280244 GCAGAACATGATGCAGGACTA pLKO_005 594 CDS 100% 4.050 2.835 N CARM1 n/a
5 TRCN0000039116 GTTGCTTTCATTGGCTCCATA pLKO.1 1294 CDS 100% 4.950 2.970 N Carm1 n/a
6 TRCN0000039118 CCCGACCAACACCATGCACTA pLKO.1 1842 CDS 100% 1.350 0.810 N Carm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.