Transcript: Mouse NM_153170.3

Mus musculus solute carrier family 36 (proton/amino acid symporter), member 2 (Slc36a2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc36a2 (246049)
Length:
2431
CDS:
119..1555

Additional Resources:

NCBI RefSeq record:
NM_153170.3
NBCI Gene record:
Slc36a2 (246049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153170.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068446 GTCCAACTCCACCATGTTTAT pLKO.1 1528 CDS 100% 13.200 9.240 N Slc36a2 n/a
2 TRCN0000068444 CAGACTGAACAAGCCTTTCAT pLKO.1 445 CDS 100% 5.625 3.938 N Slc36a2 n/a
3 TRCN0000068447 ACATTGGTTCATCTGGTCAAA pLKO.1 278 CDS 100% 4.950 3.465 N Slc36a2 n/a
4 TRCN0000068445 GCTTCCCAACCATTCTGTCTT pLKO.1 984 CDS 100% 4.950 3.465 N Slc36a2 n/a
5 TRCN0000068443 CAATCAGTCAAGCTCCTGTAT pLKO.1 1121 CDS 100% 4.950 2.970 N Slc36a2 n/a
6 TRCN0000068381 CCTACTATGGAGAGGGCATTA pLKO.1 1392 CDS 100% 10.800 5.400 Y Slc36a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153170.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.