Transcript: Mouse NM_153177.3

Mus musculus argonaute RISC catalytic subunit 4 (Ago4), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ago4 (76850)
Length:
6527
CDS:
256..2841

Additional Resources:

NCBI RefSeq record:
NM_153177.3
NBCI Gene record:
Ago4 (76850)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153177.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231978 TCACTATGATGTGGATATTAA pLKO_005 390 CDS 100% 15.000 21.000 N AGO4 n/a
2 TRCN0000009638 CGGACGGGATAGGATTGATAT pLKO.1 549 CDS 100% 13.200 18.480 N Ago4 n/a
3 TRCN0000231977 TCGACTGTTAGCCAATCATTT pLKO_005 339 CDS 100% 13.200 18.480 N AGO4 n/a
4 TRCN0000415126 TCGACTGTTAGCCAATCATTT pLKO_005 339 CDS 100% 13.200 18.480 N Ago4 n/a
5 TRCN0000011809 CGGAGCTAATAGCAATTCGAA pLKO.1 2306 CDS 100% 3.000 4.200 N Ago4 n/a
6 TRCN0000009640 GCAAGGTATCATTTGGTGGAT pLKO.1 2698 CDS 100% 2.640 3.696 N Ago4 n/a
7 TRCN0000423936 ATTCACCGCATCTAGTCTTAT pLKO_005 3155 3UTR 100% 13.200 10.560 N Ago4 n/a
8 TRCN0000415854 GACGGGAAGAAGCCTTCTATT pLKO_005 2044 CDS 100% 13.200 9.240 N Ago4 n/a
9 TRCN0000009641 GCACTTCAAGATGCAGATATT pLKO.1 465 CDS 100% 13.200 9.240 N Ago4 n/a
10 TRCN0000009639 CCCATGTTTAAACATCTGAAA pLKO.1 1738 CDS 100% 4.950 3.465 N Ago4 n/a
11 TRCN0000007875 CCTCAGAAACAATGTAGGGAA pLKO.1 1603 CDS 100% 2.640 1.848 N AGO4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153177.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.