Transcript: Human NM_153188.3

Homo sapiens transportin 1 (TNPO1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
TNPO1 (3842)
Length:
10863
CDS:
123..2795

Additional Resources:

NCBI RefSeq record:
NM_153188.3
NBCI Gene record:
TNPO1 (3842)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153188.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381292 ATTCAGCATTCCGTGGAATTT pLKO_005 2554 CDS 100% 13.200 18.480 N TNPO1 n/a
2 TRCN0000381763 GCCGTTGCATCATGGATTAAC pLKO_005 2634 CDS 100% 13.200 18.480 N TNPO1 n/a
3 TRCN0000382447 CAATGCTCAACCAGATCAATA pLKO_005 2000 CDS 100% 13.200 10.560 N TNPO1 n/a
4 TRCN0000381782 GCTGATTTCATGCCAATATTG pLKO_005 2241 CDS 100% 13.200 10.560 N TNPO1 n/a
5 TRCN0000038284 CCGTGGAATTTGTACCATGAT pLKO.1 2564 CDS 100% 4.950 3.960 N TNPO1 n/a
6 TRCN0000382164 AGTACTCAGACATAGATATTA pLKO_005 1048 CDS 100% 15.000 10.500 N TNPO1 n/a
7 TRCN0000294483 ACAATTCTATAGCGCACAATA pLKO_005 3182 3UTR 100% 13.200 9.240 N TNPO1 n/a
8 TRCN0000381424 ACGTACCTGAAGCCATTAATG pLKO_005 1548 CDS 100% 13.200 9.240 N TNPO1 n/a
9 TRCN0000038288 GCAGGGCATGATTCCATACTT pLKO.1 1409 CDS 100% 5.625 3.938 N TNPO1 n/a
10 TRCN0000038285 GCTCTAATGTTGCACATTGAT pLKO.1 744 CDS 100% 5.625 3.938 N TNPO1 n/a
11 TRCN0000291494 GCTCTAATGTTGCACATTGAT pLKO_005 744 CDS 100% 5.625 3.938 N TNPO1 n/a
12 TRCN0000038286 CCGTACTGTGAACCTGTGTAT pLKO.1 1929 CDS 100% 4.950 3.465 N TNPO1 n/a
13 TRCN0000307704 CCGTACTGTGAACCTGTGTAT pLKO_005 1929 CDS 100% 4.950 3.465 N TNPO1 n/a
14 TRCN0000382365 GTGAATCCCAGTGGCGTAATC pLKO_005 2589 CDS 100% 10.800 6.480 N TNPO1 n/a
15 TRCN0000038287 GCCTTATATTCCTATGGTGTT pLKO.1 2354 CDS 100% 4.050 2.430 N TNPO1 n/a
16 TRCN0000291432 GCCTTATATTCCTATGGTGTT pLKO_005 2354 CDS 100% 4.050 2.430 N TNPO1 n/a
17 TRCN0000040213 CCTCCCAAATTGCTGGGATTA pLKO.1 10358 3UTR 100% 1.080 0.540 Y IGF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153188.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.