Transcript: Human NM_153264.6

Homo sapiens collagen type VI alpha 5 chain (COL6A5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
COL6A5 (256076)
Length:
8896
CDS:
495..8075

Additional Resources:

NCBI RefSeq record:
NM_153264.6
NBCI Gene record:
COL6A5 (256076)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153264.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434740 TGTCAGACTTAATCGATAATT pLKO_005 3577 CDS 100% 15.000 21.000 N COL6A5 n/a
2 TRCN0000426510 ATATCCAACAGAGCTAGTATT pLKO_005 5756 CDS 100% 13.200 18.480 N COL6A5 n/a
3 TRCN0000116418 GCTACGTCATATTTGTGATTT pLKO.1 6817 CDS 100% 13.200 18.480 N COL6A5 n/a
4 TRCN0000412669 GGATCATTCAGGTAGCATAAA pLKO_005 2951 CDS 100% 13.200 18.480 N COL6A5 n/a
5 TRCN0000116419 GCCAGATTGGAACTATATCAT pLKO.1 7916 CDS 100% 5.625 3.938 N COL6A5 n/a
6 TRCN0000116417 CCATAGTTAATGCTTTCTCTT pLKO.1 8613 3UTR 100% 4.950 3.465 N COL6A5 n/a
7 TRCN0000116421 GCCAAATGTTTGAGCCACAAA pLKO.1 7204 CDS 100% 4.950 3.465 N COL6A5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153264.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.