Transcript: Human NM_153323.5

Homo sapiens defensin beta 119 (DEFB119), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DEFB119 (245932)
Length:
431
CDS:
108..374

Additional Resources:

NCBI RefSeq record:
NM_153323.5
NBCI Gene record:
DEFB119 (245932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153323.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136765 CATACGCTGCCGAAATCGTAA pLKO.1 227 CDS 100% 4.950 6.930 N DEFB119 n/a
2 TRCN0000377819 GTCGTTATTTAACAATCCAAC pLKO_005 265 CDS 100% 4.050 5.670 N DEFB119 n/a
3 TRCN0000372094 CTGTGTTCCTAGTCGTTATTT pLKO_005 254 CDS 100% 15.000 10.500 N DEFB119 n/a
4 TRCN0000133933 CCATAGAAGAACCAGTGATAT pLKO.1 145 CDS 100% 13.200 9.240 N DEFB119 n/a
5 TRCN0000135662 GATGGTGAAGACAGCATCATA pLKO.1 210 CDS 100% 5.625 3.938 N DEFB119 n/a
6 TRCN0000372093 ATGGACACTGCCGGTTGTTGT pLKO_005 184 CDS 100% 4.950 3.465 N DEFB119 n/a
7 TRCN0000133865 GAAGAACCAGTGATATCAGTA pLKO.1 150 CDS 100% 4.950 3.465 N DEFB119 n/a
8 TRCN0000134703 GATATCAGTAGAGTGTTGGAT pLKO.1 161 CDS 100% 3.000 2.100 N DEFB119 n/a
9 TRCN0000134085 CAACCAGTAACAATTCATGGA pLKO.1 282 CDS 100% 2.640 1.848 N DEFB119 n/a
10 TRCN0000135342 CAAAGATGGTGAAGACAGCAT pLKO.1 206 CDS 100% 2.640 1.584 N DEFB119 n/a
11 TRCN0000136749 GCAAAGATGGTGAAGACAGCA pLKO.1 205 CDS 100% 2.640 1.584 N DEFB119 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153323.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.