Transcript: Human NM_153368.3

Homo sapiens gap junction protein delta 4 (GJD4), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
GJD4 (219770)
Length:
1649
CDS:
228..1340

Additional Resources:

NCBI RefSeq record:
NM_153368.3
NBCI Gene record:
GJD4 (219770)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153368.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074127 CAATGTTTGCTACGACGTCTT pLKO.1 413 CDS 100% 4.050 5.670 N GJD4 n/a
2 TRCN0000426304 GAGGATCGTTTGAGAATATAT pLKO_005 1410 3UTR 100% 15.000 10.500 N GJD4 n/a
3 TRCN0000438155 TGTCAGGGCACACGAAGATTC pLKO_005 1078 CDS 100% 10.800 7.560 N GJD4 n/a
4 TRCN0000074124 GCACTACTTTCTCTTTGGATT pLKO.1 707 CDS 100% 4.950 3.465 N GJD4 n/a
5 TRCN0000074125 GCCTTGCACTACTTTCTCTTT pLKO.1 702 CDS 100% 4.950 3.465 N GJD4 n/a
6 TRCN0000438311 ACGAGCAGGAGAGGTTTGTCT pLKO_005 367 CDS 100% 3.000 2.100 N GJD4 n/a
7 TRCN0000074126 CATCATCACATTAAACTGCAA pLKO.1 257 CDS 100% 2.640 1.848 N GJD4 n/a
8 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 1374 3UTR 100% 4.950 2.475 Y GJD4 n/a
9 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 1374 3UTR 100% 4.950 2.475 Y C9orf85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153368.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.