Transcript: Mouse NM_153393.2

Mus musculus collagen, type XXIII, alpha 1 (Col23a1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Col23a1 (237759)
Length:
5665
CDS:
208..1806

Additional Resources:

NCBI RefSeq record:
NM_153393.2
NBCI Gene record:
Col23a1 (237759)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119428 GCAGGATCTTAGATGCCCTAA pLKO.1 1121 CDS 100% 4.050 5.670 N Col23a1 n/a
2 TRCN0000119427 CCAGCTTCTCACTGTCCAATA pLKO.1 2161 3UTR 100% 10.800 7.560 N Col23a1 n/a
3 TRCN0000119430 CCGAAGTGAACGTGGAGAGAA pLKO.1 1656 CDS 100% 4.950 3.465 N Col23a1 n/a
4 TRCN0000119431 CCAGGGCAATCAGGACGAGAT pLKO.1 586 CDS 100% 1.350 0.945 N Col23a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.