Transcript: Mouse NM_153396.3

Mus musculus microtubule associated monooxygenase, calponin and LIM domain containing 3 (Mical3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Mical3 (194401)
Length:
2929
CDS:
295..2889

Additional Resources:

NCBI RefSeq record:
NM_153396.3
NBCI Gene record:
Mical3 (194401)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153396.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425567 GTCACTAGGTATCCCAATATC pLKO_005 1696 CDS 100% 13.200 18.480 N Mical3 n/a
2 TRCN0000042108 CCCGATCTAATAGACTTTGAT pLKO.1 1978 CDS 100% 5.625 7.875 N Mical3 n/a
3 TRCN0000442896 TCACGCAGTTCTACGAGATGT pLKO_005 2141 CDS 100% 4.950 6.930 N Mical3 n/a
4 TRCN0000442983 CTCTGGATTTCGCCATCAATC pLKO_005 1352 CDS 100% 10.800 8.640 N Mical3 n/a
5 TRCN0000431781 ACTCATCCTGTATCAGAATAT pLKO_005 916 CDS 100% 13.200 9.240 N Mical3 n/a
6 TRCN0000042109 CCATTGCCATTACAGCAAATT pLKO.1 1019 CDS 100% 13.200 9.240 N Mical3 n/a
7 TRCN0000417575 GAGGAGACAGGGCTCCATAAA pLKO_005 2526 CDS 100% 13.200 9.240 N Mical3 n/a
8 TRCN0000420572 ACCAAGCTCACGTCCTCTTTG pLKO_005 323 CDS 100% 10.800 7.560 N Mical3 n/a
9 TRCN0000426699 ATGCCTTCTCCCGCAACAATG pLKO_005 650 CDS 100% 10.800 7.560 N Mical3 n/a
10 TRCN0000042111 GCCAAGGTGGTTGTTATTGAA pLKO.1 622 CDS 100% 5.625 3.938 N Mical3 n/a
11 TRCN0000432041 GGCAGTCACAAAGACTACAAA pLKO_005 511 CDS 100% 5.625 3.938 N Mical3 n/a
12 TRCN0000042112 CGAGGATGAGTTCTCTCCAAA pLKO.1 2715 CDS 100% 4.950 3.465 N Mical3 n/a
13 TRCN0000444525 GGCTATTCAGGAGTCAATGTG pLKO_005 1894 CDS 100% 4.950 3.465 N Mical3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153396.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.