Transcript: Mouse NM_153414.4

Mus musculus integrator complex subunit 9 (Ints9), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ints9 (210925)
Length:
2695
CDS:
228..2291

Additional Resources:

NCBI RefSeq record:
NM_153414.4
NBCI Gene record:
Ints9 (210925)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153414.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279177 TTACCAGAGACCGAGCTAATA pLKO_005 567 CDS 100% 13.200 18.480 N Ints9 n/a
2 TRCN0000192376 CCGGTCATGTATTTGTGGATT pLKO.1 529 CDS 100% 4.950 6.930 N Ints9 n/a
3 TRCN0000190299 CTGGTGGGATATTCCCAGAAA pLKO.1 900 CDS 100% 4.950 6.930 N Ints9 n/a
4 TRCN0000279231 CTGGTGGGATATTCCCAGAAA pLKO_005 900 CDS 100% 4.950 6.930 N Ints9 n/a
5 TRCN0000129616 CCAGGTGTCAAAGCTGCTTAA pLKO.1 1679 CDS 100% 10.800 7.560 N INTS9 n/a
6 TRCN0000201262 GCTGCATACGAAGGATAACAA pLKO.1 1943 CDS 100% 5.625 3.938 N Ints9 n/a
7 TRCN0000279232 GCTGCATACGAAGGATAACAA pLKO_005 1943 CDS 100% 5.625 3.938 N Ints9 n/a
8 TRCN0000200481 CCTTTCCTAAGGGAAATGAAA pLKO.1 2488 3UTR 100% 0.563 0.394 N Ints9 n/a
9 TRCN0000279168 CCTTTCCTAAGGGAAATGAAA pLKO_005 2488 3UTR 100% 0.563 0.394 N Ints9 n/a
10 TRCN0000279171 TACCATGCAACGTACTCAAAT pLKO_005 349 CDS 100% 0.000 0.000 N Ints9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153414.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.