Transcript: Mouse NM_153509.2

Mus musculus cDNA sequence AF529169 (AF529169), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
AF529169 (209743)
Length:
4250
CDS:
423..3176

Additional Resources:

NCBI RefSeq record:
NM_153509.2
NBCI Gene record:
AF529169 (209743)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153509.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125400 CCAGGCTATGATTCATTACTA pLKO.1 3036 CDS 100% 5.625 7.875 N AF529169 n/a
2 TRCN0000424824 GTCCTTGGGAAACTCAATAAA pLKO_005 2292 CDS 100% 15.000 10.500 N AF529169 n/a
3 TRCN0000125403 CGAAGCAGTCAAGAAGTTTAA pLKO.1 1769 CDS 100% 13.200 9.240 N AF529169 n/a
4 TRCN0000125402 CCAGTTTGGTTGGTACAACTA pLKO.1 1237 CDS 100% 4.950 3.465 N AF529169 n/a
5 TRCN0000125401 GCCAATAACAAAGATTGGCAT pLKO.1 2688 CDS 100% 0.264 0.185 N AF529169 n/a
6 TRCN0000434354 GACGTTGACACAATGATTAAA pLKO_005 3538 3UTR 100% 15.000 9.000 N AF529169 n/a
7 TRCN0000125399 GCAGAGACAATGGTGACAATT pLKO.1 4064 3UTR 100% 13.200 7.920 N AF529169 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153509.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.