Transcript: Mouse NM_153576.2

Mus musculus chemokine (C-X-C motif) ligand 17 (Cxcl17), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cxcl17 (232983)
Length:
760
CDS:
107..466

Additional Resources:

NCBI RefSeq record:
NM_153576.2
NBCI Gene record:
Cxcl17 (232983)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250219 GCCCTAGCACGGTTCTTATTC pLKO_005 520 3UTR 100% 13.200 18.480 N Cxcl17 n/a
2 TRCN0000184757 CTTTGCGCTGCCCTTATAGTA pLKO.1 448 CDS 100% 5.625 4.500 N Cxcl17 n/a
3 TRCN0000196049 GCAAAGATTGGTTCCTGCAAG pLKO.1 261 CDS 100% 4.050 3.240 N Cxcl17 n/a
4 TRCN0000250218 AGAATGTGAATGCAAAGATTG pLKO_005 250 CDS 100% 10.800 7.560 N Cxcl17 n/a
5 TRCN0000250216 GTGTCCCTGTGATCACGTCAA pLKO_005 328 CDS 100% 4.050 2.835 N Cxcl17 n/a
6 TRCN0000180833 GCCAGCAATTTCTCAAACGAT pLKO.1 414 CDS 100% 3.000 2.100 N Cxcl17 n/a
7 TRCN0000250217 TCCAGAGCCTGCCAGCAATTT pLKO_005 404 CDS 100% 13.200 7.920 N Cxcl17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.