Transcript: Mouse NM_153794.4

Mus musculus family with sequence similarity 210, member A (Fam210a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fam210a (108654)
Length:
9669
CDS:
298..1119

Additional Resources:

NCBI RefSeq record:
NM_153794.4
NBCI Gene record:
Fam210a (108654)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153794.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264728 TCGAAAGCAGTGGCTACATTT pLKO_005 450 CDS 100% 13.200 18.480 N Fam210a n/a
2 TRCN0000264729 TGATCACCATTGGCGCATAAA pLKO_005 375 CDS 100% 13.200 18.480 N Fam210a n/a
3 TRCN0000264727 TAATTCCTGTGCACCTAATAA pLKO_005 710 CDS 100% 15.000 12.000 N Fam210a n/a
4 TRCN0000264730 ACGATTACCCGGAGCATATAT pLKO_005 8699 3UTR 100% 15.000 10.500 N Fam210a n/a
5 TRCN0000283148 ACTTGTGCATAGAGGTGAATA pLKO_005 405 CDS 100% 13.200 9.240 N Fam210a n/a
6 TRCN0000217175 CGAAAGCAGTGGCTACATTTA pLKO.1 451 CDS 100% 13.200 9.240 N Fam210a n/a
7 TRCN0000200660 CGGCACACTTTCAAATACAAT pLKO.1 2616 3UTR 100% 5.625 3.938 N Fam210a n/a
8 TRCN0000202203 CCAGGCTCTTTGATCACCATT pLKO.1 365 CDS 100% 4.950 3.465 N Fam210a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153794.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.