Transcript: Human NM_153809.2

Homo sapiens TATA-box binding protein associated factor 1 like (TAF1L), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
TAF1L (138474)
Length:
6216
CDS:
91..5571

Additional Resources:

NCBI RefSeq record:
NM_153809.2
NBCI Gene record:
TAF1L (138474)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312721 CTTCAGCAGCATCGGAAATTT pLKO_005 5692 3UTR 100% 15.000 10.500 N TAF1L n/a
2 TRCN0000204904 CCCTTTACCACTCGGATTATG pLKO.1 485 CDS 100% 13.200 9.240 N TAF1L n/a
3 TRCN0000037499 CCTTCTATTAAGACTAGGAAT pLKO.1 1459 CDS 100% 4.950 3.465 N TAF1L n/a
4 TRCN0000327881 CCTTCTATTAAGACTAGGAAT pLKO_005 1459 CDS 100% 4.950 3.465 N TAF1L n/a
5 TRCN0000037501 CCACTGTTCATTGTGACTATT pLKO.1 4226 CDS 100% 13.200 7.920 N TAF1L n/a
6 TRCN0000195078 CGAAACTTCATCTCTACTAAA pLKO.1 5814 3UTR 100% 13.200 7.920 N TAF1L n/a
7 TRCN0000196500 GTATGAGGATTTGCTTATATC pLKO.1 5370 CDS 100% 13.200 7.920 N TAF1L n/a
8 TRCN0000349746 GTATGAGGATTTGCTTATATC pLKO_005 5370 CDS 100% 13.200 7.920 N TAF1L n/a
9 TRCN0000381889 CTCTCAGCTGTCACGTGAATG pLKO_005 3489 CDS 100% 10.800 6.480 N TAF1L n/a
10 TRCN0000037503 CCAGTGGATTTAGAGACCATA pLKO.1 4786 CDS 100% 4.950 2.970 N TAF1L n/a
11 TRCN0000037500 CCCATTTACTTTAGCGGGTAT pLKO.1 189 CDS 100% 4.050 2.430 N TAF1L n/a
12 TRCN0000196851 GCCAACAGTGTTAAGTATAAT pLKO.1 4876 CDS 100% 15.000 7.500 Y TAF1L n/a
13 TRCN0000349745 GCCAACAGTGTTAAGTATAAT pLKO_005 4876 CDS 100% 15.000 7.500 Y TAF1L n/a
14 TRCN0000195039 CCAAGCAACTTCTACGTAAAT pLKO.1 3155 CDS 100% 13.200 6.600 Y TAF1L n/a
15 TRCN0000196373 GTTACTATATTCGGGAATTAG pLKO.1 2456 CDS 100% 13.200 6.600 Y TAF1L n/a
16 TRCN0000312663 GTTACTATATTCGGGAATTAG pLKO_005 2456 CDS 100% 13.200 6.600 Y TAF1L n/a
17 TRCN0000037502 CCAGCATTCAATTCCTGCTAT pLKO.1 1914 CDS 100% 4.950 2.475 Y TAF1L n/a
18 TRCN0000079049 GCTGGGATTATGCAGCATGAT pLKO.1 784 CDS 100% 4.950 2.475 Y Taf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.