Transcript: Mouse NM_170703.2

Mus musculus CD40 antigen (Cd40), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Cd40 (21939)
Length:
1621
CDS:
73..684

Additional Resources:

NCBI RefSeq record:
NM_170703.2
NBCI Gene record:
Cd40 (21939)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_170703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066245 TGGAAGATTATCCCGGTCATA pLKO.1 729 3UTR 100% 4.950 6.930 N Cd40 n/a
2 TRCN0000066246 CCCATGTGACTCAGGCGAATT pLKO.1 252 CDS 100% 0.000 0.000 N Cd40 n/a
3 TRCN0000066243 GCAGGGTACTGGCTAAATAAA pLKO.1 1204 3UTR 100% 15.000 9.000 N Cd40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.