Transcript: Mouse NM_170786.2

Mus musculus ciliary neurotrophic factor (Cntf), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Cntf (12803)
Length:
1205
CDS:
239..835

Additional Resources:

NCBI RefSeq record:
NM_170786.2
NBCI Gene record:
Cntf (12803)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_170786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065813 CCTACCAGCTAGAGGAGTTAA pLKO.1 597 CDS 100% 13.200 6.600 Y Cntf n/a
2 TRCN0000334832 CCTACCAGCTAGAGGAGTTAA pLKO_005 597 CDS 100% 13.200 6.600 Y Cntf n/a
3 TRCN0000065814 GCTCTTATGGAATCTTATGTA pLKO.1 335 CDS 100% 5.625 2.813 Y Cntf n/a
4 TRCN0000334911 GCTCTTATGGAATCTTATGTA pLKO_005 335 CDS 100% 5.625 2.813 Y Cntf n/a
5 TRCN0000065816 CATCAGGCAATACATACTCTT pLKO.1 554 CDS 100% 4.950 2.475 Y Cntf n/a
6 TRCN0000334913 CATCAGGCAATACATACTCTT pLKO_005 554 CDS 100% 4.950 2.475 Y Cntf n/a
7 TRCN0000065815 TGTCATTTCTTCTCATCACAT pLKO.1 769 CDS 100% 4.950 2.475 Y Cntf n/a
8 TRCN0000065817 CTTGACTCAGTGGATGGTGTA pLKO.1 386 CDS 100% 4.050 2.025 Y Cntf n/a
9 TRCN0000334912 CTTGACTCAGTGGATGGTGTA pLKO_005 386 CDS 100% 4.050 2.025 Y Cntf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.