Transcript: Mouse NM_172258.3

Mus musculus solute carrier family 36 (proton/amino acid symporter), member 3 (Slc36a3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc36a3 (215332)
Length:
1758
CDS:
255..1688

Additional Resources:

NCBI RefSeq record:
NM_172258.3
NBCI Gene record:
Slc36a3 (215332)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172258.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068344 CCTGGACACTCGCTTCTATAT pLKO.1 836 CDS 100% 13.200 18.480 N Slc36a3 n/a
2 TRCN0000068345 TGCGCTAATGTTTATACAGAT pLKO.1 398 CDS 100% 4.950 6.930 N Slc36a3 n/a
3 TRCN0000068343 CCAGTCAGTCAAGCTGATGTA pLKO.1 1256 CDS 100% 4.950 3.465 N Slc36a3 n/a
4 TRCN0000068346 CTGGCTCTGATCTTCGAGTAT pLKO.1 957 CDS 100% 4.950 3.465 N Slc36a3 n/a
5 TRCN0000068347 GAACATAAGCTGTGCCACCAT pLKO.1 1541 CDS 100% 2.640 1.848 N Slc36a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172258.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.