Transcript: Mouse NM_172261.3

Mus musculus protein phosphatase 1, regulatory subunit 9B (Ppp1r9b), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r9b (217124)
Length:
4345
CDS:
337..2790

Additional Resources:

NCBI RefSeq record:
NM_172261.3
NBCI Gene record:
Ppp1r9b (217124)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172261.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105812 CCATAAGAAATATGGCTCCAA pLKO.1 474 CDS 100% 0.264 0.370 N Ppp1r9b n/a
2 TRCN0000434073 AGCAGAGATACGCCCAGTATG pLKO_005 2165 CDS 100% 10.800 8.640 N PPP1R9B n/a
3 TRCN0000105811 GATCCAAGTATTCAGCACCTA pLKO.1 1701 CDS 100% 2.640 2.112 N Ppp1r9b n/a
4 TRCN0000105810 GCCTGCTTTCTAAGTGAAATT pLKO.1 3807 3UTR 100% 13.200 9.240 N Ppp1r9b n/a
5 TRCN0000378117 GGGCCTCTTGACTTGAGATTC pLKO_005 3208 3UTR 100% 10.800 7.560 N PPP1R9B n/a
6 TRCN0000105814 GAGGAACTCCAATTCTACTTA pLKO.1 2769 CDS 100% 5.625 3.938 N Ppp1r9b n/a
7 TRCN0000105813 CCAGCTAATTCAGCAGACCTT pLKO.1 2112 CDS 100% 2.640 1.848 N Ppp1r9b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172261.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.