Transcript: Mouse NM_172269.3

Mus musculus VPS18 CORVET/HOPS core subunit (Vps18), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Vps18 (228545)
Length:
4054
CDS:
299..3220

Additional Resources:

NCBI RefSeq record:
NM_172269.3
NBCI Gene record:
Vps18 (228545)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172269.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364237 ATAAGGTGTTGGAGCTATATG pLKO_005 2448 CDS 100% 13.200 18.480 N Vps18 n/a
2 TRCN0000364236 GAGTAGCACCGAGGTCCTTTA pLKO_005 646 CDS 100% 10.800 15.120 N Vps18 n/a
3 TRCN0000093227 CCGTGTACATTATGATCTCAA pLKO.1 2371 CDS 100% 4.950 3.960 N Vps18 n/a
4 TRCN0000093228 GTCCTTTACATGAACCGCAAT pLKO.1 659 CDS 100% 4.050 3.240 N Vps18 n/a
5 TRCN0000364238 CCGTGAGTTTCCTAGCAATTT pLKO_005 1072 CDS 100% 13.200 9.240 N Vps18 n/a
6 TRCN0000093225 CCACTGTATGTGTTAAATGAA pLKO.1 872 CDS 100% 5.625 3.938 N Vps18 n/a
7 TRCN0000093226 GCAGTGATCATGCAGGACTAT pLKO.1 1976 CDS 100% 4.950 3.465 N Vps18 n/a
8 TRCN0000093224 GCCAGCCTAGTCGACATAATA pLKO.1 3867 3UTR 100% 15.000 9.000 N Vps18 n/a
9 TRCN0000381885 GGGATCACTTCCTGGAGAAAT pLKO_005 1365 CDS 100% 13.200 9.240 N VPS18 n/a
10 TRCN0000379787 AGGATGTGCTGCCCTTCTTTC pLKO_005 2655 CDS 100% 10.800 7.560 N VPS18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172269.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.