Transcript: Human NM_172349.2

Homo sapiens nuclear receptor binding SET domain protein 1 (NSD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
NSD1 (64324)
Length:
12213
CDS:
161..7444

Additional Resources:

NCBI RefSeq record:
NM_172349.2
NBCI Gene record:
NSD1 (64324)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238373 GTGCTAATTTCACGGTATAAA pLKO_005 11185 3UTR 100% 15.000 21.000 N NSD1 n/a
2 TRCN0000061357 CCACGGTTAAATGTTTGTGAT pLKO.1 3047 CDS 100% 4.950 6.930 N NSD1 n/a
3 TRCN0000061353 CCGAACACTTTCCCACTGTTA pLKO.1 7546 3UTR 100% 4.950 3.960 N NSD1 n/a
4 TRCN0000238370 AGGAGTGGATGGGACATATAA pLKO_005 4837 CDS 100% 15.000 10.500 N NSD1 n/a
5 TRCN0000238369 CAAGAAGCCACCACCTTATAA pLKO_005 4945 CDS 100% 15.000 10.500 N NSD1 n/a
6 TRCN0000238372 CCGAGACGTCTCAGGTTAATC pLKO_005 1521 CDS 100% 13.200 9.240 N NSD1 n/a
7 TRCN0000061356 GCAGCCAAGATGCAGTGTAAA pLKO.1 3785 CDS 100% 13.200 9.240 N NSD1 n/a
8 TRCN0000238371 TCCAGTGAGAACTCGTTAATA pLKO_005 1637 CDS 100% 15.000 9.000 N NSD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.