Transcript: Human NM_172375.3

Homo sapiens potassium voltage-gated channel subfamily H member 5 (KCNH5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
KCNH5 (27133)
Length:
11086
CDS:
273..2108

Additional Resources:

NCBI RefSeq record:
NM_172375.3
NBCI Gene record:
KCNH5 (27133)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172375.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429688 ATAGTGTGGTGGACGTTATTT pLKO_005 1024 CDS 100% 15.000 21.000 N KCNH5 n/a
2 TRCN0000447125 TCGGAGACTACGAGGTCATTG pLKO_005 1381 CDS 100% 10.800 15.120 N KCNH5 n/a
3 TRCN0000433147 GGACTCCATATCGCTACAATA pLKO_005 1462 CDS 100% 13.200 10.560 N KCNH5 n/a
4 TRCN0000019667 GCTGAATAATGTACGGGACTT pLKO.1 1724 CDS 100% 4.050 3.240 N KCNH5 n/a
5 TRCN0000019665 GCTGCGACTCAAGAATAATAT pLKO.1 2508 3UTR 100% 15.000 10.500 N KCNH5 n/a
6 TRCN0000433932 ATATGCAAATTGCACCAATAA pLKO_005 595 CDS 100% 13.200 9.240 N KCNH5 n/a
7 TRCN0000019668 GCGCTCCAGTGAATCAAGTTT pLKO.1 335 CDS 100% 5.625 3.938 N KCNH5 n/a
8 TRCN0000019664 GCGGTAGAGTTCCAAACCATT pLKO.1 1959 CDS 100% 4.950 3.465 N KCNH5 n/a
9 TRCN0000019666 CCTGTGTACTTTCAAGGATAT pLKO.1 644 CDS 100% 10.800 6.480 N KCNH5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172375.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.