Transcript: Mouse NM_172393.2

Mus musculus crystallin beta-gamma domain containing 1 (Crybg1), mRNA.

Source:
NCBI, updated 2017-05-03
Taxon:
Mus musculus (mouse)
Gene:
Crybg1 (11630)
Length:
7416
CDS:
779..5854

Additional Resources:

NCBI RefSeq record:
NM_172393.2
NBCI Gene record:
Crybg1 (11630)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098446 CCAGTATTGATGTGTTGGGAA pLKO.1 4689 CDS 100% 2.640 3.696 N Crybg1 n/a
2 TRCN0000098445 CGGCAGACAGAATCATCTCAA pLKO.1 5971 3UTR 100% 4.950 3.960 N Crybg1 n/a
3 TRCN0000098448 CCTGAAGTCTCTTCGCTTTAT pLKO.1 5152 CDS 100% 13.200 9.240 N Crybg1 n/a
4 TRCN0000098447 GCGGCCTATATTAAGTGATTT pLKO.1 4615 CDS 100% 13.200 9.240 N Crybg1 n/a
5 TRCN0000158490 CGAAATCAGATTCACTTGTTT pLKO.1 4928 CDS 100% 5.625 3.938 N CRYBG1 n/a
6 TRCN0000098449 CTGACCTATCCTTCTGGGATA pLKO.1 4248 CDS 100% 0.405 0.284 N Crybg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.