Transcript: Mouse NM_172401.4

Mus musculus lipid droplet associated hydrolase (Ldah), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ldah (68832)
Length:
2757
CDS:
89..1069

Additional Resources:

NCBI RefSeq record:
NM_172401.4
NBCI Gene record:
Ldah (68832)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172401.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328584 TATGGTCTGAATGGTCAAATA pLKO_005 419 CDS 100% 13.200 18.480 N Ldah n/a
2 TRCN0000200248 CCCGGTATGGATAATCTCTCA pLKO.1 313 CDS 100% 2.640 3.696 N Ldah n/a
3 TRCN0000328582 CCCGGTATGGATAATCTCTCA pLKO_005 313 CDS 100% 2.640 3.696 N Ldah n/a
4 TRCN0000328524 GCGAGATGATGACATCATAAA pLKO_005 841 CDS 100% 13.200 10.560 N Ldah n/a
5 TRCN0000182427 GCAGTGAGCAAAGGATGCTAA pLKO.1 1452 3UTR 100% 4.950 3.465 N Ldah n/a
6 TRCN0000353524 GCAGTGAGCAAAGGATGCTAA pLKO_005 1452 3UTR 100% 4.950 3.465 N Ldah n/a
7 TRCN0000182700 GCTCTATGCTACCAGCTACTT pLKO.1 658 CDS 100% 4.950 3.465 N Ldah n/a
8 TRCN0000200208 CCTTGCTTATAGAGCAGGCTT pLKO.1 2509 3UTR 100% 2.640 1.848 N Ldah n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172401.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.