Transcript: Mouse NM_172410.2

Mus musculus nucleoporin 93 (Nup93), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nup93 (71805)
Length:
2928
CDS:
98..2557

Additional Resources:

NCBI RefSeq record:
NM_172410.2
NBCI Gene record:
Nup93 (71805)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312971 CCACATGTAGAACGAAATTTA pLKO_005 176 CDS 100% 15.000 21.000 N Nup93 n/a
2 TRCN0000125226 CGGAGTTTCCTAAACATTAAA pLKO.1 977 CDS 100% 15.000 21.000 N Nup93 n/a
3 TRCN0000313016 GATGCGATATCACCGACAATC pLKO_005 1284 CDS 100% 10.800 15.120 N Nup93 n/a
4 TRCN0000125224 CTGCACACTGTCAGTATATTA pLKO.1 2583 3UTR 100% 15.000 12.000 N Nup93 n/a
5 TRCN0000312016 CTGCACACTGTCAGTATATTA pLKO_005 2583 3UTR 100% 15.000 12.000 N Nup93 n/a
6 TRCN0000125225 CGAGAGTTTGATATGATTCTT pLKO.1 1829 CDS 100% 5.625 4.500 N Nup93 n/a
7 TRCN0000311943 CGAGAGTTTGATATGATTCTT pLKO_005 1829 CDS 100% 5.625 4.500 N Nup93 n/a
8 TRCN0000125227 GCTCAGGGAATAAGTGCAAAT pLKO.1 2123 CDS 100% 10.800 7.560 N Nup93 n/a
9 TRCN0000311944 GCTCAGGGAATAAGTGCAAAT pLKO_005 2123 CDS 100% 10.800 7.560 N Nup93 n/a
10 TRCN0000125228 GCAGATGTCAAGGCATCAGTT pLKO.1 263 CDS 100% 4.950 3.465 N Nup93 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.