Transcript: Mouse NM_172440.3

Mus musculus syntaxin binding protein 5-like (Stxbp5l), transcript variant xb, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Stxbp5l (207227)
Length:
12064
CDS:
158..3715

Additional Resources:

NCBI RefSeq record:
NM_172440.3
NBCI Gene record:
Stxbp5l (207227)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172440.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100432 CGAATTACTTACTGTCATCTA pLKO.1 623 CDS 100% 4.950 6.930 N Stxbp5l n/a
2 TRCN0000100434 CCATACGAAGTATGGAGAGAT pLKO.1 2888 CDS 100% 0.495 0.396 N Stxbp5l n/a
3 TRCN0000100433 CCCACCTCAGACCATGTAAAT pLKO.1 2393 CDS 100% 13.200 9.240 N Stxbp5l n/a
4 TRCN0000100431 CCTCCAGATTTGATTCTAGTA pLKO.1 1418 CDS 100% 4.950 3.465 N Stxbp5l n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6157 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172440.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.