Transcript: Mouse NM_172448.4

Mus musculus ring finger protein 43 (Rnf43), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-04-09
Taxon:
Mus musculus (mouse)
Gene:
Rnf43 (207742)
Length:
4311
CDS:
617..2971

Additional Resources:

NCBI RefSeq record:
NM_172448.4
NBCI Gene record:
Rnf43 (207742)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172448.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040791 TCAACATCGTAGAGGGAGATT pLKO.1 1557 CDS 100% 4.950 6.930 N Rnf43 n/a
2 TRCN0000040792 ACGCCCACTATCATCTTCCTT pLKO.1 1659 CDS 100% 3.000 4.200 N Rnf43 n/a
3 TRCN0000316616 ACGCCCACTATCATCTTCCTT pLKO_005 1659 CDS 100% 3.000 4.200 N Rnf43 n/a
4 TRCN0000040790 CGCAGCGGTTACTTGGCAGAT pLKO.1 1976 CDS 100% 1.350 1.890 N Rnf43 n/a
5 TRCN0000316546 CGCAGCGGTTACTTGGCAGAT pLKO_005 1976 CDS 100% 1.350 1.890 N Rnf43 n/a
6 TRCN0000304886 GCAACTTCAGCTATATCATTT pLKO_005 3451 3UTR 100% 13.200 9.240 N Rnf43 n/a
7 TRCN0000311150 TCACTTTGGAAGGCGTGTTTG pLKO_005 804 CDS 100% 10.800 7.560 N Rnf43 n/a
8 TRCN0000040788 CCAACCCAACAGCTTCTTCAA pLKO.1 2412 CDS 100% 4.950 3.465 N Rnf43 n/a
9 TRCN0000349104 CCAACCCAACAGCTTCTTCAA pLKO_005 2412 CDS 100% 4.950 3.465 N Rnf43 n/a
10 TRCN0000040789 CTCTTTGACATCACCGAGGAT pLKO.1 1028 CDS 100% 2.640 1.848 N Rnf43 n/a
11 TRCN0000010861 CTCCACCTCATTCGCCAGCAT pLKO.1 1631 CDS 100% 0.880 0.616 N RNF43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172448.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.