Transcript: Mouse NM_172457.2

Mus musculus MOB kinase activator 3A (Mob3a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mob3a (208228)
Length:
2687
CDS:
103..756

Additional Resources:

NCBI RefSeq record:
NM_172457.2
NBCI Gene record:
Mob3a (208228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362534 GCGTGCACAGGCATCTCTTAA pLKO_005 201 CDS 100% 13.200 18.480 N Mob3a n/a
2 TRCN0000088624 CCCAAGTCTATTCAGAAATAT pLKO.1 1848 3UTR 100% 15.000 10.500 N Mob3a n/a
3 TRCN0000088626 GCATCCCAAGTGCTTTGTTAA pLKO.1 1810 3UTR 100% 13.200 9.240 N Mob3a n/a
4 TRCN0000363404 ACAAGCACTTCTACTACTTTG pLKO_005 662 CDS 100% 10.800 7.560 N Mob3a n/a
5 TRCN0000088627 CCCAAGTGCTTTGTTAAAGAT pLKO.1 1814 3UTR 100% 5.625 3.938 N Mob3a n/a
6 TRCN0000088625 GCTGGCTTCATTTCCTTTCTT pLKO.1 1727 3UTR 100% 5.625 3.938 N Mob3a n/a
7 TRCN0000363403 TACCTCCAAAGATGAACTAAT pLKO_005 1165 3UTR 100% 0.000 0.000 N Mob3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.