Transcript: Mouse NM_172524.3

Mus musculus NIPA-like domain containing 4 (Nipal4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Nipal4 (214112)
Length:
3295
CDS:
84..1304

Additional Resources:

NCBI RefSeq record:
NM_172524.3
NBCI Gene record:
Nipal4 (214112)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172524.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264901 TCAACAGGGCACTGGATATTT pLKO_005 934 CDS 100% 15.000 10.500 N Nipal4 n/a
2 TRCN0000353280 ATACAGCCTTGGTGACTAAAT pLKO_005 1504 3UTR 100% 13.200 9.240 N Nipal4 n/a
3 TRCN0000264899 ACACAGGGTTCATCGTCTTTG pLKO_005 670 CDS 100% 10.800 7.560 N Nipal4 n/a
4 TRCN0000283219 GCAGCACAGTGATGGTCATAC pLKO_005 592 CDS 100% 10.800 7.560 N Nipal4 n/a
5 TRCN0000264900 GTCCTGAAGAGCCCTACAATG pLKO_005 190 CDS 100% 10.800 7.560 N Nipal4 n/a
6 TRCN0000193368 CTTAAGAAGAAAGGCCTCATT pLKO.1 315 CDS 100% 4.950 3.465 N Nipal4 n/a
7 TRCN0000173249 CGCTTTCAAGGATTTGGACAT pLKO.1 1118 CDS 100% 4.050 2.835 N Nipal4 n/a
8 TRCN0000175081 GCTGTATTTCTTAGTACCATT pLKO.1 3096 3UTR 100% 4.950 2.970 N Nipal4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172524.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.