Transcript: Mouse NM_172532.3

Mus musculus aldhehyde dehydrogenase family 5, subfamily A1 (Aldh5a1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Aldh5a1 (214579)
Length:
5647
CDS:
94..1665

Additional Resources:

NCBI RefSeq record:
NM_172532.3
NBCI Gene record:
Aldh5a1 (214579)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172532.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191804 GCCTCATTTCTTAGATGTAAA pLKO.1 1781 3UTR 100% 13.200 18.480 N Aldh5a1 n/a
2 TRCN0000190380 CTCCGTAAATGGTACGACTTA pLKO.1 427 CDS 100% 4.950 3.960 N Aldh5a1 n/a
3 TRCN0000202046 CTGCTACATCACGCAGCAAAT pLKO.1 931 CDS 100% 10.800 7.560 N Aldh5a1 n/a
4 TRCN0000202471 GCAGGTGTCTACAACGTCATT pLKO.1 808 CDS 100% 4.950 3.465 N Aldh5a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172532.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.