Transcript: Mouse NM_172535.3

Mus musculus IQ motif and ubiquitin domain containing (Iqub), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Iqub (214704)
Length:
3651
CDS:
93..2459

Additional Resources:

NCBI RefSeq record:
NM_172535.3
NBCI Gene record:
Iqub (214704)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172535.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257736 CGACGGTTGCATGCGGTTATA pLKO_005 1089 CDS 100% 13.200 18.480 N Iqub n/a
2 TRCN0000246882 TGTATCAAACATGACCGATAA pLKO_005 1022 CDS 100% 10.800 15.120 N Iqub n/a
3 TRCN0000246883 CTTGGAGGATTTAGACATAAA pLKO_005 837 CDS 100% 13.200 9.240 N Iqub n/a
4 TRCN0000246881 GTGAGGGCTCCCAGATCATAA pLKO_005 736 CDS 100% 13.200 9.240 N Iqub n/a
5 TRCN0000191167 CCTCAAGAACTAGATAACAAA pLKO.1 3340 3UTR 100% 5.625 3.938 N Iqub n/a
6 TRCN0000007799 CCTTATGATGAGAGGAGTCAA pLKO.1 1718 CDS 100% 4.950 3.465 N IQUB n/a
7 TRCN0000192950 GCATGGTTCAAGAAGAGCTTA pLKO.1 3134 3UTR 100% 4.950 2.970 N Iqub n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172535.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.