Transcript: Mouse NM_172549.3

Mus musculus calcineurin binding protein 1 (Cabin1), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Cabin1 (104248)
Length:
7483
CDS:
463..7026

Additional Resources:

NCBI RefSeq record:
NM_172549.3
NBCI Gene record:
Cabin1 (104248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427927 GCGAGAGGAACAAGACCAATT pLKO_005 5180 CDS 100% 10.800 15.120 N CABIN1 n/a
2 TRCN0000413663 TGACCACGATTACGTCAAATG pLKO_005 4527 CDS 100% 10.800 8.640 N CABIN1 n/a
3 TRCN0000124153 CGAGAGGAACAAGACCAATTT pLKO.1 5181 CDS 100% 13.200 9.240 N Cabin1 n/a
4 TRCN0000124150 GCCCTGTTTATGTTTGAGTAT pLKO.1 3394 CDS 100% 4.950 3.465 N Cabin1 n/a
5 TRCN0000124151 CCCTTGAGATTGACAGCTCTA pLKO.1 3857 CDS 100% 4.050 2.835 N Cabin1 n/a
6 TRCN0000124152 CCTGGAGCTTATGATGCGTTA pLKO.1 1914 CDS 100% 4.050 2.835 N Cabin1 n/a
7 TRCN0000124149 TGACTTTCTTTCCAAGCCCAT pLKO.1 7300 3UTR 100% 2.160 1.512 N Cabin1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.