Transcript: Mouse NM_172569.4

Mus musculus unkempt family zinc finger (Unk), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Unk (217331)
Length:
3763
CDS:
73..2505

Additional Resources:

NCBI RefSeq record:
NM_172569.4
NBCI Gene record:
Unk (217331)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172569.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253769 GGACCGCGCAGACTGAATAAT pLKO_005 16 5UTR 100% 15.000 21.000 N UNK n/a
2 TRCN0000353404 GGTATCACCTTCGTTACTATA pLKO_005 428 CDS 100% 13.200 18.480 N Unk n/a
3 TRCN0000328179 ACACGGTAGAGTCGGTCATAG pLKO_005 1598 CDS 100% 10.800 15.120 N Unk n/a
4 TRCN0000353403 AGGCAGGTCTGAAACTCTAAA pLKO_005 2993 3UTR 100% 13.200 10.560 N Unk n/a
5 TRCN0000328115 ATGTCTACTGCACGAAGTATG pLKO_005 332 CDS 100% 10.800 8.640 N Unk n/a
6 TRCN0000040918 CGTGCCTGTCTGATGTGTTTA pLKO.1 3469 3UTR 100% 13.200 9.240 N Unk n/a
7 TRCN0000040919 GCAGTCAGTGAAATGCCTTAA pLKO.1 2364 CDS 100% 10.800 7.560 N Unk n/a
8 TRCN0000328116 TCAGCATCACATGGATCTTTG pLKO_005 1888 CDS 100% 10.800 7.560 N Unk n/a
9 TRCN0000040920 GCCACTTGAGTCAGTCAGAAA pLKO.1 1850 CDS 100% 4.950 3.465 N Unk n/a
10 TRCN0000040922 GAATTTCAAGTGCCAGGCTAA pLKO.1 1362 CDS 100% 4.050 2.835 N Unk n/a
11 TRCN0000040921 GCATCCATGAGACAGACTCAA pLKO.1 461 CDS 100% 4.950 2.970 N Unk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172569.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.