Transcript: Mouse NM_172577.3

Mus musculus solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 (Slc25a21), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc25a21 (217593)
Length:
2609
CDS:
534..1430

Additional Resources:

NCBI RefSeq record:
NM_172577.3
NBCI Gene record:
Slc25a21 (217593)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172577.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068388 CAAGGGAATTATCCCACCAAT pLKO.1 749 CDS 100% 4.950 6.930 N Slc25a21 n/a
2 TRCN0000068392 GAGATGATCTACCGGGAAGAA pLKO.1 1293 CDS 100% 4.950 3.465 N Slc25a21 n/a
3 TRCN0000068390 CGGAACTTGTTCAAAGAGCAA pLKO.1 951 CDS 100% 2.640 1.848 N Slc25a21 n/a
4 TRCN0000068389 CTGGTGTATGAATACACCTAT pLKO.1 1386 CDS 100% 0.495 0.347 N Slc25a21 n/a
5 TRCN0000068391 GAAGTGTAACAGACCCACAAA pLKO.1 664 CDS 100% 4.950 2.970 N Slc25a21 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2266 3UTR 100% 4.950 2.475 Y KAAG1 n/a
7 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 2298 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172577.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.