Transcript: Mouse NM_172611.4

Mus musculus GRAM domain containing 4 (Gramd4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gramd4 (223752)
Length:
4117
CDS:
34..1935

Additional Resources:

NCBI RefSeq record:
NM_172611.4
NBCI Gene record:
Gramd4 (223752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172611.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248344 CTCGCAGTCTTCGGCAATAAT pLKO_005 1995 3UTR 100% 15.000 21.000 N Gramd4 n/a
2 TRCN0000248343 ACAGACATCCAGAAGTATAAA pLKO_005 1747 CDS 100% 15.000 10.500 N Gramd4 n/a
3 TRCN0000248340 AGACCACGCAGAAGCTCTATG pLKO_005 1196 CDS 100% 10.800 7.560 N Gramd4 n/a
4 TRCN0000248342 AGAGGAACAAGGTGATCAAAC pLKO_005 1715 CDS 100% 10.800 7.560 N Gramd4 n/a
5 TRCN0000248341 TGGCGGTGACAGCTAGTATTG pLKO_005 1920 CDS 100% 10.800 7.560 N Gramd4 n/a
6 TRCN0000201275 GCATGGGAATTGCTGTTTCTA pLKO.1 1793 CDS 100% 5.625 3.938 N Gramd4 n/a
7 TRCN0000201089 CCTGGAATATGCTTGTGCTAT pLKO.1 3406 3UTR 100% 4.950 3.465 N Gramd4 n/a
8 TRCN0000192258 CCTTCAGATGTCACTGAGATT pLKO.1 3058 3UTR 100% 4.950 3.465 N Gramd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172611.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.