Transcript: Mouse NM_172615.4

Mus musculus RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein (Rubcn), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rubcn (100502698)
Length:
5316
CDS:
207..3032

Additional Resources:

NCBI RefSeq record:
NM_172615.4
NBCI Gene record:
Rubcn (100502698)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172615.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283271 TGTAAAGCGTGTTACCATAAA pLKO_005 2856 CDS 100% 13.200 18.480 N Rubcn n/a
2 TRCN0000265061 CTGGCAGCTGCTGGGTAATTT pLKO_005 284 CDS 100% 15.000 10.500 N Rubcn n/a
3 TRCN0000265062 CAGTGTCGCAAGCCGTCAAAT pLKO_005 4391 3UTR 100% 13.200 9.240 N Rubcn n/a
4 TRCN0000265063 GGACAAAGAAGAGCCATATTC pLKO_005 1411 CDS 100% 13.200 9.240 N Rubcn n/a
5 TRCN0000265060 CCAATGTCTGGTCCAAGTATG pLKO_005 343 CDS 100% 10.800 7.560 N Rubcn n/a
6 TRCN0000235637 GTAAAGCGTGTTACCATAAAG pLKO_005 2857 CDS 100% 13.200 9.240 N RUBCN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172615.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.